last updated 1/16/08
Education & Research Experience
2002 to present. Biological & Environmental
Sciences, GCSU, Milledgeville,
GA
2001. Biology, Georgia Institute of Technology, Atlanta, GA
1999 to 2000. Biological & Environmental Sciences,
GCSU, Milledgeville, GA
1992 to 1999. Biology, Central
Washington University,
Ellensburg, WA
1992. Cell and Molecular Biology, UC Berkeley, Berkeley, CA
1989. Gastroenterology, VA Hospital, Palo
Alto, CA
1988. Cell and Developmental Biology, Syntex
Pharmaceuticals, Palo Alto,
CA
1984 to1988. Biochemistry, Stanford
University, Palo Alto, CA
1979 to1984 (1988). Ph.D., Biochemistry, Oklahoma State
University, Oklahoma
1976-1979 B.S., Biology and Chemistry, Pittsburg State University, Kansas
1974-1976 A.A., Coffeyville
Community Junior
College, Coffeyville,
Kansas
Laboratory
Personnel
Undergraduates
Megan Culligan (Fall 2007-present)
Matthew
Fergerson, Senior (Summer 2007-present)
Mark Law, Senior (Spring
2007-present)
Sasha McKenzie, Senior (Fall
2006-present)
Alemara Montes de Oca,
Sophomore (Fall 2006-present)
Jessi Snell, Senior
(Fall 2006-present)
Graduates
Katy Bruce (Fall 2006-present)
Spencer Pucci (Spring 2006-present)
Yeast Group Meeting
All are welcome to attend!
Spring 2008 Tuesdays at 6 pm in Herty 252
Current Research
Conservation of Eukaryotic Sorting Mechanisms. The purpose of this research
is to elucidate intracellular sorting mechanisms that are conserved between
yeast and man. Using the well
characterized Kex2p prohormone processing protease (see R. Fuller for
reviews) we are examining how a close human homologue of this resident
yeast trans-Golgi protein, known as furin, can be used to probe the
conservation of these localization mechanisms. The two graduate students and the five
undergraduate listed above are involved in this research. This work continues a long line of
studies that began in the 1990s (Gleason 1995a, 1995b). Two manuscripts of
this work are in preparation and three student presentations are planned for
the Spring of 2008.
Past GCSU research:
Investigation of
Sec15 mutants. A
co-investigator in this past project, is Dr. Ellen France.
Five undergraduates, David Nix*, Daniel Price*, Chevene Simmons, Munis
Lukman and Jamie Grant contributed to this work along with Spencer Pucci*,
a graduate student. Those with an
asterisk gave presentations on their work at the Georgia Academy of Sciences
and the GCSU Student Research Conference.
Molecular Biology of Yeast Prions. A past project studied
the yeast prion, a non-Mendelian inherited trait in yeast known as [PSI+].
Important elements of this work were presented in 2002 at the Southeast
Regional Yeast Meeting and by MyQuang Pham at the 2003 meeting of the
Georgia Academy of Sciences. Recently our contributions in this work
were
acknowledged (Ganusova et al., 2006) These
studies were conducted in collaboration with Dr. Yury Chernoff in the School of Biology at Georgia Tech. Future
work could continue with the right student(s) if they are inclined to
collaborate with Dr. Chernoff’s laboratory at Georgia Tech where a number
of the experiments would necessarily take place.
Bird Phylogeny. In 2001, I began working with Dr.
Bob Chandler on bird phylogenetics. In 2003, Katie Cockeram a
graduate student presented this work at an Ornithology conference and the
Georgia Academy of Sciences. Rima
Chaudhuri, an undergraduate student in mathematics and computer science, did
important bioinformatics work creating cladistic trees with this data in
2004. This collaborative work used
molecular sequence data to supplement the osteological and fossil
characters Dr. Chandler uses in his cladistic approach to bird taxonomy.
The similarities (dashes between the letters of DNA) and the
dissimilarities (lack of dashes) is shown in an internal region of the
mitochondrial cytochrome b genes of a tauraco and a crane. A manuscript describing this work is in
preparation.
Red Crested tauraco
ctagccacacaaatcatcacaggactactgctagcaatacactac
||||| ||||||||| | || ||
||||| ||||| |||||||||
Australian Sarus crane ctagcaacacaaatcctaaccggcctactactagccgcacactac
Water Quality. In the Fall of 1999, when I first arrived at GC&SU,
my research focused on a bacteriological study of Georgia's rivers. This research
project, affiliated with the Oconee River Project, Lee Owen an undergraduate student working on this project went
on to present our work at two meetings in the Spring of 2001 and was a
contributing author on the paper describing this work (Gleason et al., 2001).
Research Prior to GCSU:
Biochemistry
snake venoms and pathophysiology envenomation, biochemistry and cell
biology of intracellular membrane sorting in eukaryotes, biochemistry of
glucocorticoid steroid hormone receptor, and immunology and virology of
rotavirus.
R. D. Wegrzyn, G. P. Newnam, K.
D. Allen, L. Ozolins, J. Birchmore, M. Gleason and Y. O. Chernoff
"Modulation of prion formation and maintenance in yeast by
cytoskeletal and stress-related proteins", SERYM 2002: South Eastern
Regional Yeast Meeting, Gatlinburg, TN, pp. 16-17. March 8-10, 2002.
M. L. Gleason, K. C. McGill and
L. P. Owen (2001) "Ampicillin Resistance in Fecal
Coliforms of Canoochee
River",
Proceedings of the 2001 Georgia Water Resources Conference, pp. 412-415.
M.
L. Gleason "Human Localization Sequences Missort the Yeast
Prohormone Processing Protease Kex2p"
Proceedings of the 6th Annual Meeting of the Pacific Division of
AAAS. Univ. of British
Columbia, Vancover, B.C. June 18-22, 1995a.
M.
L. Gleason "Human Localization Sequences Missort the Yeast
Prohormone Processing Protease Kex2p to the Cell Surface" Proceedings of Second NIH-AREA
Conference. Indianapolis, Indiana.
April 9-10, 1995b.
P.
Melançon, B. S. Glick, V. Malhotra, P. J. Weidman, T. Serafini, M. L. Gleason,
L. Orci and J. E. Rothman
(1987) "Involvement of
GTP-Binding 'G' Proteins in Transport through the Golgi Stack", Cell,
51, 1053-62.
F.
T. Wieland, M. L. Gleason, T. A. Serafini and J. E. Rothman (1987)
"The Rate of Bulk Flow from the Endoplasmic Reticulum to the
Cell Surface", Cell, 50, 289-300.
M.
L. Gleason, G. V. Odell and C. L. Ownby
(1983) "Isolation and
Biological Activity of Viriditoxin and a Viriditoxin Variant from Crotalus
viridis viridis Venoms", J. Toxicol.-Toxin Reviews, 2, 235-65.
